Evolution vs. Creationism

[ba2]

Hi Dodge, Have you ever looked at the similarities between humans and bonobos? The comparisons you always hear about are with chimps or gorillas and I almost never hear about bonobos. Where on the line would you put these creachers? I became somewhat interested when I saw them some years back in a zoo and some of these postings have jogged a few memories..

http://en.wikipedia.org/wiki/Bonobo

http://www.youtube.com/watch?v=jKauXrp9dl4

http://video.nationalgeographic.com/...os-say-no-vin/

[dodge]

Hi Ba2 -- I’ll let the experts answer that question.

In Human Population Genetics (published by Wiley-Blackwell 2012), by John H. Relethford (Ph.D. biological anthropologist), the author tells us that “numerous genetic studies have shown that humans and African great apes (gorilla, chimpanzee, and bonobo) are more closely related to each other than either is to the Asian great ape, the orangutan (page 96).

The author goes on to say that “it is clear that humans are somewhat more closely related to the chimpanzee and the bonobo than to the gorilla.”

Our closest living evolutionary relatives today are the common chimpanzee and the bonobo, and are separated from us by at least five million years. Although the name “chimpanzee” is sometimes used to refer to both species together, it’s usually understood as referring to the Common Chimpanzee, while “Pan paniscus” is usually referred to as the Bonobo.

Evidence strongly suggests that humans originated in Africa. Most estimates have put the divergence in the lines that led to humans on one hand and chimpanzees and bonobos on the other at around 6-7 million years. It is likely that the population of last human/chimp common ancestors was fragmented, with reproductive isolation occurring between the sub population that ultimately led to humans from that which led to chimps and bonobos.

At Ohio State University, researchers sequenced the bonobo genome and compared it to the genomes of chimpanzees and humans. The study, The Bonobo Genome Compared With The Chimpanzee and Human Genomes, published in Nature magazine last year.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3498939/

The authors found that more than 3 percent of the human genome is more closely related to either the bonobo or the chimpanzee than the two apes are to each other, which indicates that the three species share a complex evolutionary relationship.

According to the Bonobo Conservation Initiative, bonobos and humans share 98 percent of the same genetic make-up.

Here’s a simple phylogenetic tree that shows the divergent lines of humans, chimps and bonobos. LCA stands for “last common ancestor.”

[dodge]

One of my interests, evolutionarily, is what’s known as the “last universal common ancestor” (LUCA), also known as the “cenancestor” Although all evolutionary biologists agree that some type of cenancestor existed, its nature is a matter of speculative debate.

Earth formed about 4.6 billion years ago, and the first organic molecules appeared about 4 billion years ago. The first cells were extremely simple. The theory is that one cell, one single organism, gave rise to all subsequent life on Earth. This cenancestor, a single cell, existed at a given time and possessed most of the features (and genes encoding them) that are common to all contemporary organisms.

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGC TGCAGTTAAAAAG

It looks like gibberish, but this DNA sequence is truly remarkable. It is present in all the cells of your body, in your cat or dog, the fish on your plate, the bees and butterflies in your garden and in the bacteria in your gut. In fact, wherever you find life on Earth, from boiling hot vents deep under the sea to frozen bacteria in the clouds high above the planet, you find this sequence. You can even find it in some things that aren’t technically alive, such as giant viruses known as mimiviruses.

This sequence is so widespread because it evolved in the common ancestor of all life, and as it carries out a crucial process, it has barely changed ever since. Put another way, some of your DNA is an unimaginable 3 billion years old, passed down to you in an unbroken chain by your trillions of ancestors.

Other bits of your DNA are brand new. You have around 100 mutations in your genome that are not present in your mother or father, ranging from one or two-letter changes to the loss or gain of huge chunks of DNA.

You can tell which bits of our DNA are old or new by comparing genomes. Comparing yours with those of your brother or sister, for instance, would reveal brand new mutations. Contrasting the genomes of people and animals reveals much older changes.

Our genomes, then, are not just recipes for making people. They are living historical records. And because our genomes are so vast, consisting of more than 6 billion letters of DNA -- enough to make a pile of books tens of metres high -- they record our past in extraordinary detail. They allow us to trace our evolution from the dawn of life right up to the present.

(…from A Brief History of the Genome, M. LePage, New Scientist, September 15, 2012, pp. 30-35)

http://www.chem.uwec.edu/Chem452_F12...ePage_2012.pdf

(…and Lectures in Astrobiology, Volume 2, copyright 2007 edited by Muriel Gargaud, Herve Martin, and Philippe Claeys)

http://books.google.com/books?id=ZvE...page&q&f=false

However, the nature of the cenancestor, whether it was a discrete entity or a diverse community of cells is disputed. Whatever it was, the widely endorsed universal tree of life, first defined by sequences of small subunit ribosomal RNA, recognizes three major domains (Bacteria, Archaea and Eukarya).

Having said that, it is commonly accepted that cellular life originated from the cenancestor, which occurred in the Hadean ocean of the ancient Earth around 4.5-5 billion years ago; and gave rise to the diversification of prokaryotic life and the evolution of all cellular organisms.

[ba2]

Hi Dodge, hope all is well with the weather you have experienced this past year.

Somehow, I would have thought that the Bonobo would have been a closer relative than the Chimp. What I personally observed was a primate that did a lot of walking upright, sometimes holding infants while walking, not as smooth as humans, but much better than Chimps. Interactions seemed much more human like (hugging and what even appeared to be kissing). I overheard another zoo patron suggest that this has to be the missing link. I don’t know about that but I later found that Bonobo have face to face sex and often use it when making up after a fight or for lifting the spirits of another that may be sad or depressed. Mothers have lifelong bonds with their sons but never have sex with them. Nevertheless, Bonobos are very sexy animals and might even attempt it with a human handler. They are very peaceful animals, more than either Humans or Chimps. I don’t know what it means but, they are clearly bi-sexual.

Your Ohio State link was interesting but pretty technical making it difficult for the novice like me to follow. It does point out that Bonobos and Chimps are actually pretty different, some Bonobo traits are more humanlike than Chimp and some Chimp traits are more humanlike than Bonobos. Some of this is pretty technical.

The other two links don’t seem to be working.

Been pretty busy but sometimes have a chance to follow some of these discussions. Many are pretty silly.

[dodge]

Hi Ba2 -- This past winter has been up there with one of the worst I’ve experienced; but the snow is all but gone and I feel Spring in the air.

You’re certainly right that most of the discussions here are “pretty silly.” I’ve been trying to raise the bar by starting threads concerning current issues like gay marriage, climate change, origins of life and the universe, and abortion; but nobody seems interested (or intelligent) enough to engage in serious rational debate.

As to the bonobos/chimp place in the evolutionary history of life, I've done a bit of research and found that we know our human lineage separated from chimp lineage about six to seven million years ago.

Duke University has a page in their evolutionary anthropology section about bonobos and chimps, how they’re both our closest relatives and how they differ from each other.

http://evolutionaryanthropology.duke...chimps-bonobos

Also, the University of New York at Oswego has a paper by zoology student Ryan Laughlin concerning the evolution of the Bonobo (Pan paniscus), who explains that “bonobos are physically separated from chimpanzees only by the Congo River, but this separation, which has persisted over a long period of time, has lead the bonobos and chimpanzees to follow distinct evolutionary pathways,” being “the result of genetic drift rather than adaptation to different environments.”

http://www.oswego.edu/Documents/wac/...12/zoology.pdf

There was a recent article published at Emory about how bonobos exhibit empathy by comforting friends in distress.



http://news.emory.edu/stories/2013/0...on/campus.html

They do seem quite human-like.